EST details — SGN-E303437

Search information 
Request: 303437Match: SGN-E303437
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94245Clone name: cLEX-2-P14
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192128 [TUS-64-M22] Trace: SGN-T344016 EST: SGN-E543141 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303437Length: 559 bp (870 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303437 [] (trimmed) GTGGATCTGAAATCACGTGTAGATGGACCAGCCCAAGCTTATGTCGTCGAGGCTAGGGTTGATAGAGGACGGGGTCCATTGGCTACTGCAATAGT
GAAAGCAGGGACCCTTGTCTGTGGTCAGCATGTTGTTGTAGGTGCCGAGTGGGGAAAAATCAGGGCTATTAGGGATATGCTAGGAAAATCAACTG
ATAGGGCTAGGCCAGCTATGCCTGTAGAGATCGAAGGACTCAAGGGGCTTCCAATGGCTGGTGATGACATTATTGTCGTTCACACTGAGGAAAGG
GCAAGGATGCTTAGCGCTGGGAGGAAAAAGAAATTTGAAAAAGATAGACTTGGGAGGAAGATGGACGCAGAAAAATTAGGAGCTCTAGTGTCAGA
ATCTAATTTAGAAGATGAAGAAGGTGAGGTTGAAGAGAAGCCCAAGAGGGTTGAAATGACAATAATAGTAAAAGCAGATGTTCAGGGAACTGTCC
AAGCCGTTACAGACGCATTGAAGAGTTTGGATAGTTCTCAGGTTTTCGTGAATATTGTCCATGGAGGTGTTGGGCCTATTTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303437] SGN-U579912 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115525 [Download] [View] Facility Assigned ID: TRXAH91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5