EST details — SGN-E303532

Search information 
Request: 303532Match: SGN-E303532
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94006Clone name: cLEX-2-B22
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
See unigene SGN-U564473 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303532Length: 537 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E303532 [] (trimmed) GAGTGTTAGCTGTGAAATGAACTTTGGGTACTCACTTGCAGATCGAATCTAGCATTTTCAGGGATCATTCTCTTTTCCATTGCTGGTTTTGTGGT
GTCACATCCTGTTTACTGTATGTCCAAGGGAACCGTAGCACAGCGTAGTCCGCCTGATGTTCTTCAGTAGCCTTATTATGCTTGATCAACGCCAA
GATGGGCGACTTCTCTTCGAAAATTCAGGATTTGTTGTTTTTAAGCGTGCTGTTGCTTTGCATTTTCCCAAGACTTACACTAGCACTCAATCCTG
ATGGTCAAGCGCTTGTCAATTTTAGGATTGCAATATCTGGTTCCGATGGTGTTCTTGAGCAGTGGAGACCAGAAGATTCTGACCCATGTGGCTGG
AAAGGGGTACAATGTGACTCAAAATCAAAGAGAGTTACATCTTTAAGCCTCCCTAATCACAAACTGAGTGGATATATATCACCAGATATTGGGAA
GCTAGACCAGTTGCAGTTTCTGGCTCTTCATGACAATAATTTCTATGGGGCAATACCTCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303532] SGN-U564473 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115620 [Download] [View] Facility Assigned ID: TRXAH11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5