EST details — SGN-E303572

Search information 
Request: 303572Match: SGN-E303572
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98362Clone name: cLEY-6-A5
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C98362 [cLEY-6-A5] Trace: SGN-T118538 EST: SGN-E303573 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303572Length: 427 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303572 [] (trimmed) GGTGAGTTCTGCAAAAGTAGGGTTTTCTTGCAAACACATCGCGCAGCCTCGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACC
CAAAGAACTACGGCCCTGGCTCTCGCACATGCCGTGTGTGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAGACAGTGC
TTCCGCAGCAATGCCAAGGAAATTGGCTTCATCAAGTACCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAG
AAGACATATGGCATTAGAGCTTTTTGATTTGCATCTCCCTTCAGTTAAATGATGTAATGGGATAATTTTGATTTATGTTTTAACTTTTGGAAGTA
ACTGCTATGTGAACCTAAGAAAGACTAGCTTTTAAGATTTTAAAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303572] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118537 [Download] [View] Facility Assigned ID: TRYAU03THC
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0010 Quality Trim Threshold: 12.5