Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E303638

Search information 
Request: 303638Match: SGN-E303638
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98363Clone name: cLEY-6-C11
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C98363 [cLEY-6-C11] Trace: SGN-T118544 EST: SGN-E303579 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303638Length: 472 bp (860 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E303638 [] (trimmed) AGATCAACTGCTCAGTTTCTATTAGTAATTTGGATGTGAAATACATTACTTGCTAGCTGGATTTATTAATGCAGCTGTGAAATACACTATTTCTT
CAAAAGTGTCATATGTACACTAAGCATTCTTTGTGAACTTACAACATAATTCAATATTCTGCAAAAACGAGATATAGTTCAACATCATGACTTGC
CATTAGTTAGCAAGTCCTTGTTTCCTGCCATCCTCATTTGGTGAATTCACGACTACATCTGTCAGCTTGCAAGGCTCGGCTTCTTCCAGCATATG
AACTACCATCCTCATGGAAGGTCTTAATGCTGGCGTCCTTGATGTGCAATGAACTGCAATTTTAAGAACCTCAACTGCATCTTCTTTGAACCCCT
CGAAAATGCTTGAATCCACCAAATCGATCATGCTAGTATTGTTTCTTATCTTGCTACAAACCCATTGGACTATGTCAATGTTCTCCCCGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303638] SGN-U577069 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118603 [Download] [View] Facility Assigned ID: TRYAU18TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0044 Quality Trim Threshold: 20.5