EST details — SGN-E303898

Search information 
Request: 303898Match: SGN-E303898
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94389Clone name: cLEX-4-A14
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303898Length: 286 bp (916 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E303898 [] (trimmed) GAATAAGAGGTATATAATTCCTTCTAAATTTTCATATCTTACACTTTCTTTTTTCATAAAGGTTACATACGTGATGTCGAATTCAGATAGAAGAA
GTAACCATATCGCGATTATACTAGTTATAACAATCCTTCAATTTCTACTCCTAAATATTGTTAAAGCCCATGACTACAACACATTTCAAGAATTG
CCATCTACACAAGATGAAGCAAACTTCAGGCCAAGTATAGCTGGTGGTATTGGTATTCTCTCCATCATGTTTTCCTTAACATTCCTTCTACTTCT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303898] SGN-U577130 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115835 [Download] [View] Facility Assigned ID: TRXAN07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.933 Expected Error Rate: 0.0140 Quality Trim Threshold: 14.5