EST details — SGN-E303898
Search information |
Request: 303898 | Match: SGN-E303898 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C94389 | Clone name: cLEX-4-A14 |
| ||
Library Name: cLEX | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: root
Development Stage: fruit-set stage/post-fruit loading
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E303898 | Length: 286 bp (916 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E303898 [] (trimmed)
GAATAAGAGGTATATAATTCCTTCTAAATTTTCATATCTTACACTTTCTTTTTTCATAAAGGTTACATACGTGATGTCGAATTCAGATAGAAGAA
GTAACCATATCGCGATTATACTAGTTATAACAATCCTTCAATTTCTACTCCTAAATATTGTTAAAGCCCATGACTACAACACATTTCAAGAATTG
CCATCTACACAAGATGAAGCAAACTTCAGGCCAAGTATAGCTGGTGGTATTGGTATTCTCTCCATCATGTTTTCCTTAACATTCCTTCTACTTCT
C
GTAACCATATCGCGATTATACTAGTTATAACAATCCTTCAATTTCTACTCCTAAATATTGTTAAAGCCCATGACTACAACACATTTCAAGAATTG
CCATCTACACAAGATGAAGCAAACTTCAGGCCAAGTATAGCTGGTGGTATTGGTATTCTCTCCATCATGTTTTCCTTAACATTCCTTCTACTTCT
C
Unigenes |
Current Unigene builds | |||||
[SGN-E303898] | SGN-U577130 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T115835 [Download] [View] | Facility Assigned ID: TRXAN07TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.933 | Expected Error Rate: 0.0140 | Quality Trim Threshold: 14.5 |