Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E303971

Search information 
Request: 303971Match: SGN-E303971
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94537Clone name: cLEX-4-J6
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192169 [TUS-64-O15] Trace: SGN-T344087 EST: SGN-E543212 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192169 [TUS-64-O15] Trace: SGN-T349716 EST: SGN-E548841 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E303971Length: 514 bp (1003 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E303971 [] (trimmed) ATTTGTTGAGTTTTTTCCCTCAGGTATCTCAACTATGTCATTTTCTTATTGAATCATTGAACCCCCATAATCTGTTCCGTTTAAACAAACACTGT
TGTCTGATGTGGAACCATATTCGTGAGGGGTATTGATAGAAGATACATATGTTGTTCCTGAACTCATTAGTCCAATTGATAGTGAAAATGTTCGA
GAATAATTGTGTTTCACTTAAGTGATTTGAAGACATTAGAAAACAAATGAGATTAACACGGCTTGTGTTCATTCGTTCAATCAAAATTATTACAA
TTCGAACACAATTGGAGACATTTACAATAGAAAAGTCGATCAAAATCAACCAACAGTATTTTAAAGGAATAAATTATGGGTGGTTTAATGATGAG
GAAAAAAATCCAACTAATTTAAGGATCTGTTTATGTATTTGACCTTAATATATATATATATGTTATTAATGAGCGTAGGCATGGAGTAATGGAAG
AATATATTCACCAAGACACCAAGTGTTGATGAAAGAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E303971] SGN-U569662 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T115908 [Download] [View] Facility Assigned ID: TRXAP51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5