EST details — SGN-E304000

Search information 
Request: 304000Match: SGN-E304000
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94867Clone name: cLEX-6-A23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94867 [cLEX-6-A23] Trace: SGN-T116156 EST: SGN-E304138 Direction: 3' Facility: TIGR
Clone: SGN-C192248 [TUS-65-B22] Trace: SGN-T344222 EST: SGN-E543347 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192248 [TUS-65-B22] Trace: SGN-T344223 EST: SGN-E543348 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304000Length: 375 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304000 [] (trimmed) TCCCCATCGAAACAAAGAGAAAAAACACTTCAGACGTTTACTTCTATCGTTACAAAGGTCAATTATTAACCGCTCCTCTTCACGAAAGCTTTGGA
ATCCCACATCCAACTGATGTTGAAGCACTTCAAAGCTTCACCACACTTATGTGGCCACAAGGCAACCAAAGATTTTGTGAAACAATGACATCGTA
CATAAAGGTAGGAGCAGAAATAGAACAGTTGGTTGATAAAATGGTGTTTGAAAGCTACGGATTACCAGAAAAGCACTACGAATCTCATGTCGCAG
CTACTACATACCTCCTCCGCCCCACCAAGTACAGAGCAGCACCTGCTGGGGCGGAGGACGGTATTGGCAATGTAGGTTCCAATATACATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304000] SGN-U569664 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116018 [Download] [View] Facility Assigned ID: TRXAU12THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0075 Quality Trim Threshold: 14.5