Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E304048

Search information 
Request: 304048Match: SGN-E304048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94979Clone name: cLEX-6-K13
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94979 [cLEX-6-K13] Trace: SGN-T116204 EST: SGN-E304186 Direction: 5' Facility: TIGR
Clone: SGN-C192279 [TUS-65-D5] Trace: SGN-T344276 EST: SGN-E543401 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192279 [TUS-65-D5] Trace: SGN-T349747 EST: SGN-E548872 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304048Length: 591 bp (758 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E304048 [] (trimmed) ACACCCTGCAAATCTGCCTTTTATTAGGTTTAACGACAATATAAAGCTTTCAAGGAATCTTGTGACTACAAGTTTGCCTATTAGGTTTATCATCA
ATTGAAAGCTCCACATGAATCTTCCGCTGATAAACTCCATTGACCCCAATTATTGTCCATCTTCTTGACACCTTCATGTACACTTACAACCAAGG
AAGTTTAAAAGTATCTTTCAACCATCCTTGTCTGAAGGAGTTAGCAAATATTTTATTCATCCGCACAATGACCTCAGAAAATGTTGGCCGGACAA
AAGCTTCTGGATCCCAACATTCTTCAATCAACTCTCTAAGCTCAGGAGGATATTTGGATTTCGATTTGAATACTGGTCTCTGGCCTTCTAAGCAC
ATCAACCTGGCAGTCTCTTCTGGAGACTTGGTATTAAAAGGTGGTGTTCCCTCCAGCATCTCATAGAGTAAAATGCCAAATGAATATATGTCCGC
ATTCCGGTCAAATATTTCATCTTTATAAATCTCAGGTGCTACATAGGGACTTGAACGGTCAAAACCCTCCGGCTGCACCAACTTTGCTTTGTCAG
GTGAAATTTTTGACAATTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304048] SGN-U569625 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116066 [Download] [View] Facility Assigned ID: TRXAU67TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5