EST details — SGN-E304182

Search information 
Request: 304182Match: SGN-E304182
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94954Clone name: cLEX-6-I23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94954 [cLEX-6-I23] Trace: SGN-T116060 EST: SGN-E304042 Direction: 5' Facility: TIGR
Clone: SGN-C192274 [TUS-65-C24] Trace: SGN-T344267 EST: SGN-E543392 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192274 [TUS-65-C24] Trace: SGN-T344268 EST: SGN-E543393 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304182Length: 488 bp (761 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E304182 [] (trimmed) ATTTATTGAGCAATCAAAACAAGAAGATACAATGTCTACATAATTAACAAATTAACACACAACTCTACAAAGTCTCTCCATTCGCAATTAACTTG
CTTTATGGAACAGAGGCTCTTGAGTAAAAATCACAATTACACTGGAAAACAATCAAATTCTTGAAACAATTATTCATGAATCAACATTATCTTAG
ACGTTCACCTTCCTGCAGTTTACGCGAATTTGGCCTTGATTCCCTGTCAATGGCTTAATATTTCCCATCTTAATCATAGACTCGGCAAAATCTTT
AGAGAAACTCCCGAGGTTGGTACTATATTTCTTAACAAGATTATCAGTTTGACCGCCATTAAATAGTGCTTGATCAGAGTGCAAAAGTCCTTTCT
TGGACACCAAGTTACTAAAATATTTTGAATCAAAAAGAGCTGGAGTTGGATCAAGTGGAGCAAGGTTGGTATTGCCTCCACTGCGTGGACAATTG
GCTTTGCGTTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304182] SGN-U576374 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116200 [Download] [View] Facility Assigned ID: TRXAU60TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5