EST details — SGN-E304476

Search information 
Request: 304476Match: SGN-E304476
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92780Clone name: cLEX-12-J12
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192464 [TUS-65-K22] Trace: SGN-T344594 EST: SGN-E543719 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192464 [TUS-65-K22] Trace: SGN-T349799 EST: SGN-E548924 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304476Length: 516 bp (1025 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304476 [] (trimmed) GGAATCATTGAAGGAGAATACTGGAATGGAAAGTTCTGTAGCTGCAGAAAATGATAGTAATCCCCCAGAGGATGATGTGAAGGAGAGGTGTTGGG
ACCAAAGAGAAGCGCTGCCGGGTGAGCCTCGATGTATCGTATGTGGCCGCTATGGTGAGTACATTTGTGATGAGACTGATGATGATATTTGCAGC
TTGGAATGCAAGGGTATATTGTTGTCGCGGCTTGGAGAATCACGGCAACCTACTGCTCGTCCATGCCCTGTGAAGTTACCAGCAACTGATGAGTG
CTATTATGTAAGGGATAATGGTAAGTCTGAAGTGAATCCGCTAACAACTGAGCAGACTGAACTTCTGAGAAGGAAACTTGATATTCTTGTGAAGG
GAGATACTACACCGCCTCCCATCTTGTCATTTGCTTCTTGCAAGCTACCTCAGAAGCTTCTCGAGAATATTGAAGTTGCTGATTATGAAATGCCA
ACTCCTGTTCAAATGCAAGCAATCCCTGCTGCTTTAGCACG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304476] SGN-U573667 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117341 [Download] [View] Facility Assigned ID: TRXBV54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5