Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E304595

Search information 
Request: 304595Match: SGN-E304595
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C92638Clone name: cLEX-11-P23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192436 [TUS-65-J18] Trace: SGN-T344545 EST: SGN-E543670 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192436 [TUS-65-J18] Trace: SGN-T344546 EST: SGN-E543671 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E304595Length: 455 bp (938 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E304595 [] (trimmed) GAGCAAGTGAAATTGTTTGGAGCTTTTCCAAGTCCCTTTAGTCATAGGATCATTTGGGCTTTGAAACACAAGAATATTAGTTATGAATACATAGA
AGAAGATCTTTCTAACAAAAGCCAACATCTTTTGACATATAACCCTATCTATAAGATGATCCCAATTCTTGTACATAATGAAAAACCAATAGTTG
AATCAACAATCATTCTTGAATACATTGAAGAAACATGGCCCCAAAATCCTTTGTTCCCAAAGGATCCTTATGAAAAGGCTAAGGCTAGATTCTGG
ATCAAGTTCGGAGAAGATAAGAACTCAGAATTTCATCAAATATTTCACAAGATTGGAGAAGAGCAAGTCAAGGCAACTGAAAATGCCAAAAAAAT
CCTAAAAATTATAGAGGAACAAGGTCTTGGAGATAAAAAGTTTTTTAGTGGGGATTCAATTGGTTTAATTGACAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E304595] SGN-U567445 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T116951 [Download] [View] Facility Assigned ID: TRXBQ96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0217 Quality Trim Threshold: 12.5