Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E305138

Search information 
Request: 305138Match: SGN-E305138
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96953Clone name: cLEY-18-P18
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193042 [TUS-67-C24] Trace: SGN-T345586 EST: SGN-E544711 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193042 [TUS-67-C24] Trace: SGN-T345587 EST: SGN-E544712 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305138Length: 510 bp (1043 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305138 [] (trimmed) GCTTTTCTGCAGCATTTCAAGATGTCAAACATTCATGGTCTCGGCAAAGTAACCAAGAACGAGAAGAAAGATGTTGAGGAATTCTCCAACTCGAC
GAAGCAATCAAGCTCAACAGCGGTATGGAAGCCAATTCCAACTGGCGACACCACCCAAGATGTCATTGCCAAAGCGAAAAGTCTTTCCAGAGAAG
CTCCTTCTGGCGGCGCCCTCGACCGGAATATCGCTCTCATCACAATCTATAAGAATGGATTTCAAATTGGAGAGGCTCCTTTTCGCGACTTGAGC
TCACCAGAAAACAAACAATTCCTCGAAGACCTTCGCAACGGCGAGGTGCCCGCTGAGTTAGAAGGCGAAGTACGATCAAACTTTCCCAATGCTCG
AGAAGTGGCTGTGAATTTGGTCGACAAATCATCTGAAGAATATCAAGTACCAAAGCCAAAGTTTGACTTTGCCAAATCTCAAGGCCTGAGTCTGG
GAAGCTCATCAGGAGGCTCTTCTGCACAAAACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305138] SGN-U568170 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120378 [Download] [View] Facility Assigned ID: TRYCT93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0138 Quality Trim Threshold: 12.5