Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E305368

Search information 
Request: 305368Match: SGN-E305368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93560Clone name: cLEX-15-A3
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192577 [TUS-65-P15] Trace: SGN-T344788 EST: SGN-E543913 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C192577 [TUS-65-P15] Trace: SGN-T349831 EST: SGN-E548956 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305368Length: 362 bp (867 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305368 [] (trimmed) GTCGCAAACCAACATTGCCTTTCGAGTTTCGCAGGCTAACCTGAAAGAACAACAGCTAACTCCAGCCCAGAGAGAGCAGTGCCGTCGAAATTTCG
CCAAATACGACACAGACAATAGCGGAACACTTGACAAGCAAGAGTTTCGTGCCTTATTAGAAGATACCTTGAACCGAAAAATCTCGGACAATCTA
TTTGCCAAATACTTTGAAATACAATTCAATGCTACAGATGCAGACTACAATGGTAGTATTGACTTTAATGAATTTGTTTCACTCTACAGCAAGAT
TTATTTGGATCCAGAGCTCCCTGTACATGGATACAGACAAGTAGAGAAAAAGGTGGTTTTGGAAACAGGAGAGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305368] SGN-U570709 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117854 [Download] [View] Facility Assigned ID: TRXCE02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5