EST details — SGN-E305433

Search information 
Request: 305433Match: SGN-E305433
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93754Clone name: cLEX-15-K10
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: Alias clone SGN-C185222 is on microarray TOM1: SGN-S1-1-5.2.12.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305433Length: 390 bp (910 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E305433 [] (trimmed) TTAACTTACAAAAACCAGAAAGAGCACATAATTTGTTTTGACACAAACGCATATAAGAAAGTACAGAGTTACAAAAGAACAACACTGTATGACAT
TATAAAGAGATTATGAACTCAAGTATGGAAACTCCATTACTTTTTCAGCCAATTCCTCCTATGGTAATAGAAGAAATAATTCATGGGCAGACTAA
AAGCCCCTTTCAGGATAAGAACTTGACTAATTACAAACATTGTAAATACCCCATTTTCATGTTACTGAGCTTCAACAATCTCTAAGCCTTGCACA
CCAACAAGTCCAGAAATGTTCTAAGATTGTGGATACACCTTCCTTTTCACAAGCTTGGCATGCACTCACATTGCATATATGATCTCCCCGCTGCT
ATCAATATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305433] SGN-U586079 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117919 [Download] [View] Facility Assigned ID: TRXCF65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5