Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E305580

Search information 
Request: 305580Match: SGN-E305580
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93245Clone name: cLEX-14-C12
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180073 [TUS-33-G15] Trace: SGN-T186485 EST: SGN-E374033 Direction: 3' Facility: INRA
Clone: SGN-C180073 [TUS-33-G15] Trace: SGN-T186486 EST: SGN-E374034 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305580Length: 636 bp (888 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305580 [] (trimmed) GAAACCAAAGAACTATAGAGATATACTATGGGTTCTCTAACAACTCCACCAAAACTACTAGTAGTAGATTTCAACAATGAAGAATTAAGGCCAGG
CACAACTACTTGGGAATCTACCTGTAAAGAAATTAGACATGCCTTTGAAAACCATGGTTGTTTCATAGCACTTTATGACAAAATTTCACCACAAC
TTCAAAAATCCATTTTTCAAGATAATTCACAACAATTATTTGAACTTCCTTTAGAGAGAAAAGTCCTAAACATTAGTGAAAAGCCTTATCATGGT
TATGTTGGCCAAATTTCATTTCTACCTAATCATGAGGCTTTTGGTATTGATTATGCAACTACTTCTCAAGGTATTCAAACCTTTTCCAACCTCAT
GTGGCCACAAGGAAATGACTCTTTCTGTGAGAGTTCGTTGATGTTTTCCAAGATTGTGGCGGCGTTGGACAACAAGGTTGTTAGAATGTTATTTG
AGAGCTATGGAATCACAAAAAATTGTGAATCATATGTTGAATCAACCACATATCTCCTTAGATATTTGAAATATAACACTCCAAAGACTAAGGAA
ACTAGCATGGTGTTTCCCCCTCATACCGATAAAACGTTCACTACCATACTATACCAAAATCACATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305580] SGN-U562860 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118066 [Download] [View] Facility Assigned ID: TRXCB18TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5