EST details — SGN-E305611

Search information 
Request: 305611Match: SGN-E305611
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93511Clone name: cLEX-14-O16
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180142 [TUS-33-J12] Trace: SGN-T186992 EST: SGN-E374378 Direction: 3' Facility: INRA
Clone: SGN-C180142 [TUS-33-J12] Trace: SGN-T186993 EST: SGN-E374379 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305611Length: 678 bp (854 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305611 [] (trimmed) GCTCAGCGCTTCCGGCGACTATTTCCGTCAAAGGTACTTGGTGAAAATTCTTCGAGTAACGAAGTTCTGTTGGAGCTGATTAGGGATGGCTCCAA
AGCAGCCAAATACAGGCCTTTCTGTGGGTCTTAACAAAGGACATGTTGTTACTAAGAAAGAGTTGGCTCCCCGCCCTTCTGATAGAAAAGGGAAA
ACCAGTAAGAGAATACATTTTGTTAGAAGCCTTATCAGGGAAGTAGCTGGTTTTGCACCTTATGAGAAGAGAATTACTGAGCTTCTTAAAGTTGG
AAAAGACAAACGTGCTCTTAAGGTAGCCAAGAGGAAGCTGGGTACTCACAAGAGAGCAAAGAAGAAGCGTGAAGAGATGTCCAGTGTTCTCCGTA
AAATGAGGGCTACTGGAGGTGGTGAAAAGAAGAAATGAGTTGTATGCTAACCCCTCAATATGAAATGTTAGGTTCTGAAACTGCTTTGCCAAGAT
CTACTTTTTAGTATCTATTTGATTTTTGATCATTTTTATTGTTGAACACGTAACACTCAGCCTTTTATCGCTTTTGTTTCAGTACGAGAATTGTT
CAATTTTTTTTTGACATTTCGATTTTGCAACTCATTTGTATGTGAATTAAAACTGTACCAAGTCTTGTATCTGGAATACCAGATACATTTTGTAA
TGTACATACTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305611] SGN-U581074 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118097 [Download] [View] Facility Assigned ID: TRXCB92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0030 Quality Trim Threshold: 12.5