EST details — SGN-E305626

Search information 
Request: 305626Match: SGN-E305626
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93314Clone name: cLEX-14-F19
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180089 [TUS-33-H7] Trace: SGN-T186818 EST: SGN-E374204 Direction: 3' Facility: INRA
Clone: SGN-C180089 [TUS-33-H7] Trace: SGN-T186819 EST: SGN-E374205 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305626Length: 335 bp (436 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305626 [] (trimmed) GGAGATATTCAACCAGAAGCATGGACTCATCTCCGGGAATTTTCAATCTTTTGGATCAAGATGTTCAGTTTCCGGCGACAATCAGAAATCACATA
CAGCAAGCCACACCAGCTCTTGGACCACCACCGTCACGTCCCCCGCCACCTCCACCACCACCTTCTAAGAATATAGAAAGCCCCAAAACACCCTC
ACCTCGACTTTCAAAGCCAGCATTTAACCCTCCAGTTCTTGAATCTCCTTTAAAACCCATTGGAATTGAGAGTCCAGTATTGGTTTCTCCAATGG
AGTTGCCTTCTGTTTCGGAACATATTGAGAAGGATGATGAGAGAACTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305626] SGN-U576757 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118112 [Download] [View] Facility Assigned ID: TRXCC34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5