EST details — SGN-E305778

Search information 
Request: 305778Match: SGN-E305778
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93514Clone name: cLEX-14-O2
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180145 [TUS-33-J15] Trace: SGN-T186748 EST: SGN-E374134 Direction: 3' Facility: INRA
Clone: SGN-C180145 [TUS-33-J15] Trace: SGN-T186749 EST: SGN-E374135 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305778Length: 570 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305778 [] (trimmed) GAATTCCTTCTTTGTTTTCCTTTAAATTTATTCATCAATGGCATCTACCAAAGTTAAGATTCCCACCATAGATTTTTCTAATGAAGAACTAAAAC
CAAACACTCCATTATGGGAATCCACAAAAGTTCAACTTTTTGAAGCTTTCCAAGAATATGGTTGTATTGAAGCAATATATGGTGAAAATCCAAAT
GAAATTAGAGAGGGTATCTTTGATATTGAAAAAAAAATATTTGAATTTCCCTTAGAGACAAAAATGAAAAATCATTCAGAAATACCATTACATAT
TGGCTACATAGGGCAAATTCCACACTTGCCATCTTATGAGAGTTTGTGTATTCCTAATTTCCTTGCTCCTCAAAGTGTTGAAAATTTTGCTAATA
TATTTTGGCCTCATGGTAATCCTGAATTCTGCAATTTGGTCAAATCTTATGCAAATTCACTTCTGAAATTGGATGAAATGATAAAAAGGATGATT
TTGGAGAATTTGGGATTAGAAAAGCACATTAATGAATTATTGGATAATTTTGTCCTATTTAGATTTACCCATTACAAGGGAACATTATCTATTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305778] SGN-U580863 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118264 [Download] [View] Facility Assigned ID: TRXCB85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5