EST details — SGN-E305807

Search information 
Request: 305807Match: SGN-E305807
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93361Clone name: cLEX-14-H23
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180109 [TUS-33-I3] Trace: SGN-T186404 EST: SGN-E373952 Direction: 3' Facility: INRA
Clone: SGN-C180109 [TUS-33-I3] Trace: SGN-T186405 EST: SGN-E373953 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E305807Length: 331 bp (425 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E305807 [] (trimmed) GTAAAAGTGTAGCAATTTCATATATAACTATAGTATTTGAAATGGCTTCCAATAGCTTCTTTCTTCTTCATGTTTTGGTCATGTTTTCTCTAGCA
AGCATGGCACTTTCGGATTCTCTTTCACCTTCTTTCTATAATCATGTATGTCCTGAAGCTTTGCCAGCCATAAAACGAGTCGTTGAGGATGCAGT
CAGGAAAGAGAGGCGAATGGGTGCCTCTTTGCTACGTTTACACTTTCATGATTGTTTTGTCAATGGGTGTGACGCTTCAATTCTTCTAGACAAAA
CGGCTACTATTGACAGTGAAAAGACTGCGATACCCAATAACAATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E305807] SGN-U576374 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118293 [Download] [View] Facility Assigned ID: TRXCC48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5