EST details — SGN-E306005

Search information 
Request: 306005Match: SGN-E306005
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96685Clone name: cLEY-17-B12
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192985 [TUS-67-A15] Trace: SGN-T345488 EST: SGN-E544613 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192985 [TUS-67-A15] Trace: SGN-T345489 EST: SGN-E544614 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306005Length: 617 bp (890 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306005 [] (trimmed) GTGAAAGTACCTGAAAACGATCCGACTCACTCCAATTCCCTACTCCTTCAATCTCTTCTTGATTCCATTCCCCACACCCAAAGCTTCAAAGGCAA
ATGGTCTTTAATCAGAACCAAACTCTCTACCCTTCAGAGTCACCTTTCTGACCTCTCTACTGCCCCCATCAACGCTTTCCACAATCCACTTTACA
ATGACCTCCTTCAGTCGCTGTCTGTCACTCTAAAGGATGCTTTTGCTCTTTCATCCATTTGCCACAGTGCGAACCCGCCTGAAGGTAAACTCAAG
ACCCAGAATGATATTGATTCCGTTGCTGCAAAAATTGATAACCATGTGAGGGATTTGGAGGTTCTTGTTAAGAATGGGGTTCTTCAAGAAAACGG
TGCTGTTTCGACCAATATTACATCGAAGAGGGAGACTATACGGGCGGAATCGAGGAATCTGATAACACGGCTTCAGATCGGGACGACTGAGTCGA
AGAACTCGGTTTTGGATTCGTTACTTGGGTTGTTACAGGAAGATGACAAGAATGTATTGATTGCAGTAGCTCAAGGGATTGTTCCGGTGCTTGTG
CGGTTACTCGATTCCAGCTCTTCGCCGGAGATCAAGGAGAAGACAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306005] SGN-U574123 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120289 [Download] [View] Facility Assigned ID: TRYCP06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0043 Quality Trim Threshold: 14.5