EST details — SGN-E306147

Search information 
Request: 306147Match: SGN-E306147
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95930Clone name: cLEY-13-N4
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192841 [TUS-66-K15] Trace: SGN-T345241 EST: SGN-E544366 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192841 [TUS-66-K15] Trace: SGN-T345242 EST: SGN-E544367 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306147Length: 532 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306147 [] (trimmed) CCCCGGCTTGCAGGAATTTCGGCAAGGACTAAGTCTATACATGGAGAACAAGAACAAAGCTGAATATTATAGTCCTGATGATGAAGATCGCGATA
TCGATAATCAAGAAAATATTATCCATCAAGGAGGTGCTGTTAATGTTATGGTAAAGAGAGAAAGATCCCCACCGGAACACAACTCAATGGCTTCT
TCATCTACTCACAAAGAACAGGACGATCAGCTAGCATCAGCCAAAGATGAAATGCGAGAAGTAATGGAAGAAAATCAGAGGCTTCGAATGCACTT
AGATCGAATGATGAAGGAATATCGAAATCTCCAGAACCAATTTCACGATATCGTTCAAAAAGAAACTGATCAAAAATCAAGCAGTACTACTGTCA
ACACTAGTACAACACATCATGATCATGAATCTGATCAAGAAGCTGATCAACTTGTGTCCCTCAGCTTAAGAAGAACTACTAGCGATATGAAGAAA
GATGATTTATCTAAAATCTTAAAGAAAGATAAAGTTCATGACGATGAAGGAGTTAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306147] SGN-U571280 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119325 [Download] [View] Facility Assigned ID: TRYBZ74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5