EST details — SGN-E306169

Search information 
Request: 306169Match: SGN-E306169
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95846Clone name: cLEY-13-I13
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192830 [TUS-66-K4] Trace: SGN-T345223 EST: SGN-E544348 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306169Length: 502 bp (859 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306169 [] (trimmed) GAAACTCTTCAAACTTGTTCTTTCTTCTTCACATTTCCATCTCCTAAAACCCTCCTTAAACCCATAAATTCTTCTAAATTCACTTCTTTTCCTTT
CTTTAATCTCTCTACTTCATCCAATTTCAAGCATTCTCCTCTTACTCTTCACTGTTTCAGTTCAGATGAATACCCAGTAGGTGATGACGACGCGT
TTCTCGAAGCTTTTGGACCCAAAGAGAAAGAATCCGAAGAAGAAGCCCGGCGCAGGAACTGGGTCGACCGTGGTTGGGCTCCATGGGAAGAAATC
CTCTCACCTGAAGCTGATTTTGCTCGGAAATCTCTTAATGAAGGTGAAGAAGTTGCGCTTCAGTCACCTGAAGCTATTGAAGCTTTCAGAATGCT
TAGTCCGAACTACCGGAAAAAGAAGATTGAGGAAATGGGTATAACGGAAGATGAGTATTACGCTCAGCAATTTGAGATTAAAGGAGATATTCCTG
AGCCTCTGGAGACTACATGGGCAGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306169] SGN-U575984 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119347 [Download] [View] Facility Assigned ID: TRYBW55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5