Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E306229

Search information 
Request: 306229Match: SGN-E306229
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95958Clone name: cLEY-13-P5
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192847 [TUS-66-K21] Trace: SGN-T345251 EST: SGN-E544376 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192847 [TUS-66-K21] Trace: SGN-T345252 EST: SGN-E544377 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306229Length: 509 bp (947 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306229 [] (trimmed) GGTGAAAATGGCAGCGTTGTTGAGGAAGCTAGCCAAGGCTGCACCCATAGCATTTCGAGGCGATTCCAAGTCAAATTTTGCTGATCCTCGCTTCC
CCTTTGGAGCTATTGCAGCCGTTGCTGGATGCGTCTCTTATTATTACTGCCATTCTTCTGCGAATTTGGTGTACTTGGAGCAAATCAGTGAAGAT
TCGGGTAAAAAAGTTGCTCTAAATCCTGATAAATGGATTGAATTTAAGCTGCAAGATCGAGCTCCAGTTAGCCACAATAGTCATCTATTCAGGTT
TTCATTTGATCCTTCTTCAAAGTTAGGTCTTGATATTGCATCTTGCATTCTTACGAGGGCACCAATGGGAGAAAATGCTGAAGGAAAACCAAAAT
ATGCCATTCGGCCTTACACTCCTATATCTGATCCAGAAGCCAAGGGATACTTTGATTTGTTAATTAAGGTTTATCCAGAAGGGAAAATGAGCCAG
CATTTTGCAAAACTGAAGCCGGGGGATATACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306229] SGN-U564251 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119407 [Download] [View] Facility Assigned ID: TRYBY87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0121 Quality Trim Threshold: 14.5