Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E306329

Search information 
Request: 306329Match: SGN-E306329
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93098Clone name: cLEX-13-K8
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192518 [TUS-65-N4] Trace: SGN-T344686 EST: SGN-E543811 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192518 [TUS-65-N4] Trace: SGN-T344687 EST: SGN-E543812 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306329Length: 538 bp (940 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306329 [] (trimmed) GCTGCTTTTACAGAATTGATTTTAAGATAAGAACAATTGAACTTGATGGCAAGCGGATTAAGTTACAAATTTGGGATACAGCTGGTCAAGAGCGT
TTCCGCACTATCACAACAGCGTATTACCGAGGAGCAATGGGGATTCTGCTGGTGTATGATGTCACGGACGAGTCTTCTTTCAATAGTAAATGCTC
TCACTAGCTTGCGTCAATGCTCTTCTTTTGTAACTTCGATTTTTTTCTCAATTCATTTTTTCGCTACCTGCTTATATATGTAGACGTTCTATCGT
TCAGTGTGATCTTTCTTTTGCTGAGAGATGTGATAATTTTGTTCCAATTTTGAGCTTAAGCTGGTTTTATGGTCTCAAGTTGCAGTTGCATGACC
ACCTTTCAAAAATTGCTCTTTGATAACCAGATTCAGCATTTGCCAGAGCAGATTTAACTTAATTGTTTAATGTTTAACTGAACCATTCAGACATC
AGGAACTGGATTCGCAACATAGAGCAGCATGCTTCTGATAATGTCAACAAGATTTTGGTCGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306329] SGN-U578707 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117422 [Download] [View] Facility Assigned ID: TRXBX64TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5