EST details — SGN-E306343

Search information 
Request: 306343Match: SGN-E306343
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93177Clone name: cLEX-13-O22
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192531 [TUS-65-N17] Trace: SGN-T344708 EST: SGN-E543833 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192531 [TUS-65-N17] Trace: SGN-T344709 EST: SGN-E543834 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306343Length: 286 bp (973 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306343 [] (trimmed) ATCATCGTTCAATTCTGACTAAATTAAGCGATCGAAGATGTTTCAAAAAGATGCGCGAAGGAATCTACGGCACTAAATACTATGAAATCTTAGGT
GTTCCTAAAACTGCTGCACAAGAAGATCTCAAGAAAGCTTACCGTAAAGCTGCTATTAAGAATCATCCTGATAAGGGAGGTGATCCTGAAAAGTT
TAAAGAGCTTGCACAAGCTTATGAGGTTCTGAGTGATCCCGAGAAGCGTGAGATATATGATCAGTATGGAGAAGATGCTCTCAAAGAAGGAATGG
G
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306343] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117436 [Download] [View] Facility Assigned ID: TRXBX95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0266 Quality Trim Threshold: 14.5