EST details — SGN-E306670

Search information 
Request: 306670Match: SGN-E306670
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97022Clone name: cLEY-19-E3
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306670Length: 347 bp (887 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306670 [] (trimmed) ACCCACAAAGTTAGTGGGCTAGATTGGAGAGTTTTCGGAACACCCTGTTGAGTTCTGATCAAAACCCATAAATTTGTTTGGTTAATGGTGTGGCT
CTTCGGACACCCTATTGAGTTCTGATCAGAACCCAGAAATTTTCTTGGTTTTTTTTTTTATATGATCGAAGATGTATAGCAATTTTAAGGAGCAA
GCAATTGAGTATGTAAGGCAAGCAGTGCAAGAGGACAATGGTGGAAACTATGCAAAGGCATTTCCGTTGTATATGAATGCATTGGAGTACTTCAA
GACCCATTTGAAGTGCGAGAAGAATCCTAAGATAAAGGAGGCCCATTACCCAGAAATTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306670] SGN-U573763 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120517 [Download] [View] Facility Assigned ID: TRYCU26THD
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0152 Quality Trim Threshold: 20.5