EST details — SGN-E306725

Search information 
Request: 306725Match: SGN-E306725
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97084Clone name: cLEY-19-K16
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306725Length: 397 bp (954 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306725 [] (trimmed) GGAGTAGAAATGGCTTTGGGTGGAGGTGGACCGCAAAGGGGGACTGCAGCAGCAGCAGCTGCTAACCTACGTCGAAGGAAGACAGGAGGAGCAGG
TGGAGCTGCAGGAGGAGCAGGTGGTACCATGCTCCAATTCTACACTGATGATTCCCCCGGACTCAAGATATCCCCCAATGTTGTGCTTGTAATGA
GTATTGGCTTTATAGGTTTTGTCGCAATCCTTCACGTCATGGGTAAGCTTTACTTTGTCCGCAGAGAGGGCTAGAGCCATCTCATTGCTGACTTT
TGAAACTTTTGTTGGGCAAACAGCTTTCTAGTGAAAGGAAAACTGACATTGTAGATTTGTTTTCTTGTTTGTTTGTCTATGCAATGAAGTTTATA
GAAAAGTTTTCATAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306725] SGN-U578689 Tomato 200607 Build 2 989 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120572 [Download] [View] Facility Assigned ID: TRYCV68THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5