EST details — SGN-E306984

Search information 
Request: 306984Match: SGN-E306984
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95386Clone name: cLEY-11-L1
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192742 [TUS-66-G12] Trace: SGN-T345071 EST: SGN-E544196 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192742 [TUS-66-G12] Trace: SGN-T345072 EST: SGN-E544197 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306984Length: 535 bp (1001 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306984 [] (trimmed) GGAAGAGATCATCGGGGCTGAAAAACCTTCAGTTCGCCGGCGATTGTTCGGCGGAGAACCCTGTTTCCACAGTTCCATAGATTTATCTAGTTGTT
AGATACTTAAACATCCTACTTCATCTCACTTGATGTCTCGGAAACGCAATGTCATTGTTGCCACAGGCTTGCTAGTCTTTGCATCTGCTGGCTTA
TCCTTTCCGTTTTACATGGCGTCAAGATCATCAAGGGCAACTCCAGTCATTGATTCATCAAAGCCATTGCCACCCCAGGCGACATTTCGTGGCCC
TTACATCAACACGGGATCGCGTGATATTGGACCTGATCATCAAACATACCCTAAGAAATAACATCTTTCTTGATTAGATATTAGTTTTGCTAGTT
ATTGAAGTCACTCTAGATTTCCCCTTTTTCTTTCTATTCAATGAAAAGAGATAATAATGAGAGTCTGTTGAAACTGGCTCAGGAGAAATTAGCAT
GTTTGAGAGTGATCCAAGAGCACCCTAGCTGGCCTGGACACCATTGTTATCGAAAACTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306984] SGN-U570177 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118908 [Download] [View] Facility Assigned ID: TRYBQ61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5