EST details — SGN-E306985

Search information 
Request: 306985Match: SGN-E306985
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95398Clone name: cLEY-11-L5
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192744 [TUS-66-G14] Trace: SGN-T345074 EST: SGN-E544199 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192744 [TUS-66-G14] Trace: SGN-T345075 EST: SGN-E544200 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306985Length: 569 bp (1013 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E306985 [] (trimmed) GAAAACGTGAAAGGGAGAGGAGAACAAGCATTTTGGACTTCGGATTGTAAGGGTTCTTAGGCAATAAGAAAGACAAAGGCTTTGGAGAGGTAGCT
TGCTTGATTTCGGTTCTTCGGTGGAGCAAGCGTACCGTCGTCTTCAACTCGATCGAAATTCTAGCCAGTCTTCATTACATCGAATTTCAGGGCAT
CCAAGTATTCGAAAGATGATTTCGAGAATCTACCCTGCATCTCATTATGGTTGTTGAATGAGACACCTTGGGGAAAATATTCGAAATAACTTTTA
CATTCAAAGGTAGTGTACAATTTTTATAAAGCAGCAAAGGCGTACGATATATGTGAGTTCAATGACCATTTCAATCAAATAAAAGATTTGGTACC
AAAGGCCGCTGAAGCTCTTGAACGTATTGAATTTCACACATGGAGTAGGACATTTTGCCTGGGAAATAGATATAACATTATGACGTCAAACATCG
CGGAATCAGTGAATGCTATGGTTGATGATGAAAGAGAATTTCCCATTCCGCTCTATTTGATGAAATAAACAAGAGATTTAAATTTTTATCTCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306985] SGN-U578828 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118909 [Download] [View] Facility Assigned ID: TRYBQ63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5