Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E307021

Search information 
Request: 307021Match: SGN-E307021
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96247Clone name: cLEY-15-C1
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307021Length: 410 bp (967 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E307021 [] (trimmed) GAAATTGAGCACCCAATTAAGGCATTTGGGTGGGCTTCTAGAGACACTTCTGGTGTTCTTTCTCCTTTCAACTTCTCAAGAAGGGCTACTGGTGA
GAATGATGTACAATTCAAAGTGTTGTATTGTGGAATTTGTCACACAGATCTACATATGCTCAAGAATGAATGGGATAATTCCAAGTACCCTATTG
TGCCAGGGCACGAGATCGTGGGCGTACTAACCGAAGTCGGTAGCAAGGTAAAAAAAGTGAAGGTGGGGGACAATGTATGTGTTGGAGTCATAGTA
TGATCATGTCGAAAATGTGATAGTTGTACTAGTGACCTCGAACAATATTGTTCTAGCAGTATTAACACGTATAGTACAACTTACTATGACTGAAC
CACCACATACGGAGGCTACTTCCATCTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307021] SGN-U578688 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119444 [Download] [View] Facility Assigned ID: TRYCE13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0246 Quality Trim Threshold: 14.5