Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E307610

Search information 
Request: 307610Match: SGN-E307610
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96620Clone name: cLEY-16-M8
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192965 [TUS-66-P19] Trace: SGN-T345454 EST: SGN-E544579 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192965 [TUS-66-P19] Trace: SGN-T345455 EST: SGN-E544580 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307610Length: 626 bp (985 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307610 [] (trimmed) GCAAATTTCATAAGAAGAGTAAAAAGAGAGAGCCACCACCTCCTACAATAGGCTTGATTTTTCTCTCTCGTTTCTCATTTCACTTTAGCTAAATG
GGTATTTGGAGCAACCTAGTTGTGCTCCTCGTTATTTTCCCTTTTTGTACATCAGATCCAAACGATGAGATGTGCTTGACTCATCTCAGTCAATC
TTTACAAGACCCTCTGAAGAATCTTCAAAACTGGACTAAATCCTCTTTCGCTAAACCTTGTGATGGGTTCACTTCATATCTACAAGGGGCAACTT
GTAACAATGGCCGAATCTACAAATTATCCCTTTCCAATCTCTCGCTTAAAGGTACCATTTCTCCTTATCTCTCTAATTGCACCAATCTACAAGCT
CTGGACCTCTCCTCCAACGCAATATCCGGCCCAATACCTCTAGAACTCCAATTCCTAGTCAATCTGGCTGTTCTCAACCTCTCAGCTAATCAACT
TTCAGGCCCAATTCCTGAACAGCTCGCCATTTGCGCTTACCTCAACGTCATCGATCTTCATGATAATCAGCTTAATGGGCTCATCCCCCAGCAAC
TAGGCCTCCTTGTACGGCTATCAGTTTTCGACGTATCCAACAATAGATTATCGGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307610] SGN-U574639 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119964 [Download] [View] Facility Assigned ID: TRYCJ76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5