Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E307648

Search information 
Request: 307648Match: SGN-E307648
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96603Clone name: cLEY-16-L3
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192961 [TUS-66-P15] Trace: SGN-T345447 EST: SGN-E544572 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192961 [TUS-66-P15] Trace: SGN-T345448 EST: SGN-E544573 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307648Length: 616 bp (1046 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307648 [] (trimmed) GCTCCTCTTCCAAAAACCCTCTCAGGCTGGTGCAAAACATGTTTATGCCATAGAGGCATCTGAAATGGCCGAACATGCTAAAAAGCTTATTGCAG
GAAATCCATCATTGAATGAGAGAATTACAGTAATCAAAGGAAAGGTTGAAGAAGTAGAGTTACCTGTGAAAGCCGATATCTTAATCTCTGAGCCA
ATGGGTACTTTGTTAGTTAATGAAAGAATGCTGGAGTCTTATGTGATTGCAAGAGATCGGTTTCTAGTTCCAAATGGAAAAATGTTTCCTGCAGT
GGGAAGAATACACGTGGCACCATTCAGTGATGAATATTTGTATCTGGAAATTGCAAATAAGGCTATTTTTTGGCAGCAACAGAGCTATTTTGGGG
TTGATTTAACACCCTTGCAAAGATCTGCATATGAAGGATACTTTTCTCAGCCAGTGGTTGATGCTTTTGATCCAAGGTTATTGGTAGCTCCTGCA
ATATCTCATGCGATTAACTTCACTTTAATAAAGGAAGAAGATCTATATGAAATTGAGATCCCATTGAAATTTGCATGTTCTGTTAGCACTAGAAT
TCATGGGCTGGCTTGCTGGTTTGATGTACTATTCAATGGAAGCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307648] SGN-U567451 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120002 [Download] [View] Facility Assigned ID: TRYCK62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5