EST details — SGN-E307830

Search information 
Request: 307830Match: SGN-E307830
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97263Clone name: cLEY-20-I10
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307830Length: 209 bp (1097 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E307830 [] (trimmed) GCTGAAAATGAATTATTCTCATCTCATCTTTGTTTTTACCATCATTCTTGCTTATTCCTCTGTTTCAATTCTTGCACAACAGCCTTATTTTGGAA
CTGGAACAAATGACTGCAGCAGCCAAGATACCTCCACTTCTGCTTTTGGGTATTTATGCAATGGCGTTAACCGTACTTGCCAATCTTATTTGACC
TTCAGATCTCAACCCCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307830] SGN-U564297 Tomato 200607 Build 2 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120640 [Download] [View] Facility Assigned ID: TRYCZ53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.932 Expected Error Rate: 0.0265 Quality Trim Threshold: 14.5