Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E307868

Search information 
Request: 307868Match: SGN-E307868
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97265Clone name: cLEY-20-I15
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193091 [TUS-67-F1] Trace: SGN-T345670 EST: SGN-E544795 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193091 [TUS-67-F1] Trace: SGN-T345671 EST: SGN-E544796 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307868Length: 513 bp (982 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307868 [] (trimmed) GATTCCTTCTTCAAGTAACCAATTTTTATTTTTATTTTTTTGAAATATTTCATATATTATTATAATGTGTCCAACTATGAATATTTTGGCAACTG
AAAAAATTAAGGAAAATTATGAGGGGAAAAATGAGTGTAGATATCAAAAAGGAGTTAGACATTTATGTGAAAGTGGAATTACTAAAATTCCAAAA
AAAAATATATTTTGCCAATTTCAGATAGGCCTTTAATTGTGAAAAAAGAAGAAAAAATTGAAGAAAATCTCAATTTGCCTATTATTGATTTTGCT
CAATTGCAAGGCCCCAATAGATCTCAAGTTCTCAAATCACTTGCCAAAGCTTGTGAAGAATATGGTTTTTTTCAGTTGGTGAATCATGGTATACA
TAGTGACACAATTCAACACATCATTGAAGTTGGCAAGAAATTCTTTGAACTTTCCCTTTGAAGAAAGAGCAAAATACATGTCTATTGACATGCAA
GCACCAGTAAGAATTGGGCCAAGTTTCAATCAAAATAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307868] SGN-U562670 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120678 [Download] [View] Facility Assigned ID: TRYCY56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0092 Quality Trim Threshold: 14.5