EST details — SGN-E307877

Search information 
Request: 307877Match: SGN-E307877
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97224Clone name: cLEY-20-C20
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193087 [TUS-67-E21] Trace: SGN-T345664 EST: SGN-E544789 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193087 [TUS-67-E21] Trace: SGN-T349975 EST: SGN-E549100 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307877Length: 265 bp (998 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E307877 [] (trimmed) GAGTTTTAGAGAGAGAAAAAAGAGGGAGTTTTAGAGAGAGAAATTAAAAGAGGAGAGAAGTACGGCCAATGGGAGACTCGAGCGGCTCCGTTTCG
GTGGATATGGAAACAATCTCCGTCACCGGAAAGGAGCACCTTGTAAAAACTGGCCGTGGTTATGTCTCTGTTGCCGTTTTTGGGGACCAGGACAA
GCCGGCTCTTATCACCTACCCTGATTTAGCTTTAAATTATATGTCCTGTTTCCAAGGATTATTCTATTGTCCAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307877] SGN-U585749 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120687 [Download] [View] Facility Assigned ID: TRYCZ22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5