EST details — SGN-E307902

Search information 
Request: 307902Match: SGN-E307902
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97217Clone name: cLEY-20-B3
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E307902Length: 500 bp (1051 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E307902 [] (trimmed) ATTTAAACAATGGTAGTTGGGATTACTGCGGAATGAAGTTCTCTCTTCATAGTAATGTACCATGAGAACTCATAAATGAAACTTAATATGATCCA
GAGTCTATAAATTACCTTACAGTATGAATTAAAAGAGTATTATACAAAGCATTATTTCGATCATGAGCGCTCCACAAACACTCACAGAGATGAAC
TTAAATGATTAAGATCCACGAATCCAAAAAGAACTGCACGGTTACGTTCCTTAACCTTCACTTGAGAGATAACTCTCAACCCTTCCAACCACATT
TCTGTGATTAAAGTTTCTCCTGGATAGACATGTAGTAGAAATCTGCCAGATACGCTCTTTATCGTGTTCTGAGCACCTCCACAAATACACTTAAT
AATAGTCCTAACTGCAAATCCAAGTGTGCACAACCCATGCAGTATTGGACGAGAAAACCCTGCACCTTCTGCGAACTTTGGATCTGAATGCAATG
GATTGTAATCACCAGATAGCCGATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E307902] SGN-U564562 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T120712 [Download] [View] Facility Assigned ID: TRYDA02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.923 Expected Error Rate: 0.0077 Quality Trim Threshold: 20.5