EST details — SGN-E308142

Search information 
Request: 308142Match: SGN-E308142
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95967Clone name: cLEY-14-A14
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192850 [TUS-66-K24] Trace: SGN-T345256 EST: SGN-E544381 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192850 [TUS-66-K24] Trace: SGN-T345257 EST: SGN-E544382 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308142Length: 292 bp (936 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E308142 [] (trimmed) GGTAGGCTCATATCGAGGCGGCTATCATGGCACATTTACTTTCTACTACATGTTCTTTAAATGTCTCTTCCAGCAAAAAGCTACATTTCAAGTCA
ATTAACCAATGCTCTACTCCTAATCCAACATGTTTTAATATGGGAATTTCTTTCTCACCCTTGAAGCTAAGTTTGCAAAGCAAAAGGTCTGCAAA
ATATGTGATCAGAGCTTCAGCTGGTTTCATGAGCCAAGAAACCCGAACACAGAATGACTCTGGTTCTCAACAAACCACTGATGGAGCATCCACTC
AGAAGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308142] SGN-U580292 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119825 [Download] [View] Facility Assigned ID: TRYCB07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5