EST details — SGN-E308229

Search information 
Request: 308229Match: SGN-E308229
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C96179Clone name: cLEY-14-N22
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192886 [TUS-66-M12] Trace: SGN-T345319 EST: SGN-E544444 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308229Length: 555 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308229 [] (trimmed) GCTTTTTTCATGCAGAGGTCACACAAGGTAAGTGCACATGATTGATTCTTTCTTCCAGAAACCCCAAAAATCTTAGTTGTCCTCTGAAATTCCAT
TAACTTCTGAGGTGCTGTTTTTCATTTTTCTAAAGAAAGATTGGATTTTTATGCATTTTGAGCCTATTGTGTGTACTTCTTGAACTTTTGGCTTT
GTGGGGTTGTGCTGAAAGTGTATGTTTTGGTTATTCTTGGAAAGTAGAACAACTTTATGTGTCAAAAATGGTGTTGAAGTTCTGAAAAAAGGGAG
GTTTTTAAGGGGATTTTTTTGCTTCTTTCTTTTTTTCTCTGAGTTTTACAGTTGAAGTTTATCTTTCTCATTTCTCACAGAAAGATTTGATTTTT
ATGTATTTTTATTCAGTAGTGTACTCTTCTTGAACTTTTGGCTTTGTGGGGCTGTGGTATAAATGGTGTTGGAGTTCAGAAAAAGGTAGATTTTT
GGAGGGGTTTGCTTCTTTCTTTTATTACACTCTTGAGTTTATAGTTGAAGCCTTATCTACAAATGGGAATAGGCATTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308229] SGN-U564976 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T119912 [Download] [View] Facility Assigned ID: TRYCD83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.899 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5