EST details — SGN-E308319

Search information 
Request: 308319Match: SGN-E308319
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C100308Clone name: cLEZ-6-K21
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100308 [cLEZ-6-K21] Trace: SGN-T121928 EST: SGN-E308320 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308319Length: 577 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E308319 [] (trimmed) GAAAACCCATTAATTATGAGTGATTACAAAATCCCCAAAATTAATCTCACCAAATTAGACAAGCACTCAAATTCTTGGGTACCATTATGCAATGA
GGTTCGACATGCCCTTGAAGAACATGGTTATTTTATAGCACTATATGAGGATGCTAATAATAAAATTTCCAAGGAAATATTTGATGTAATGGAAG
AATTATTTGATCTCCCCATCGAAACAAAGAGAAAAAACACTTCAGACGTTTACTTCTATCGTTACAAAGGTCAATTATTAACCGCTCCTCTTCAC
GAAAGCTTTGGAATCCCACATCCAACTGATGTTGAAGCACTTCAAAGCTTCACCACACTTATGTGGCCACAAGGCAACCAAAGATTTTGTGAAAC
AATGACATCGTACATAAAGGTAGGAGCAGAAATAGAACAGTTGGTTGATAAAATGGTGTTTGAAAGCTACGGATTACCAGAAAAGCACTACGAAT
CTCATGTCGCAGCTACTACATACCTCCTCCGCCCCACCAAGTACAGAGCAGCACCTGCTGGGGCGGAAGACGGTATTGGCAATGTAGGTTCCAAT
ATACATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308319] SGN-U569664 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121927 [Download] [View] Facility Assigned ID: TRZAU71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5