Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E308377

Search information 
Request: 308377Match: SGN-E308377
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98006Clone name: cLEY-25-F16
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308377Length: 371 bp (884 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308377 [] (trimmed) GGACATTATGATTTGCCGCTAGTGCTATGCCCGTTTGCACCCACGTGCTGTGAACTGCAGGAAGAAGAAATGCGGTCACAGCAATCAGTTGAGGC
CAAAGAAGAAGATCAAGTGTACAGTCGGTTGCATTTCATGTGGAGATGTTATGCCTATTGCATGATTTTGTAGTTCTTTTGCTTAGCTCACATTT
AGCTGGATCTATTGTTGTCTGTTTAACTGTGGTACAGCATTCGTTTAGACTCCAGTTCCATTTACAAAAAGAATTTATTGCTCTTTCGAGTTCGT
TATAATTATGGGCTGTTTTTGTTTTCTTTATCTTCGCCAAAAACAGAGACGCAAGCTCAAAAGAAATAATCTCGAGGGGGGGCCCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308377] SGN-U580503 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121640 [Download] [View] Facility Assigned ID: TRYDV32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0133 Quality Trim Threshold: 12.5