EST details — SGN-E308476
Search information |
Request: 308476 | Match: SGN-E308476 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C97409 | Clone name: cLEY-21-G4 |
| ||
Library Name: cLEY | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: root
Development Stage: pre-anthesis/pre-fruit loading
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E308476 | Length: 297 bp (867 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E308476 [] (trimmed)
GCAGAGAACTACAGAGTCTGATGCCAGTTTAAGCCACGAGAGCACCACTAATGACGCTAAGGATGAACTGTGAGATATGTAGGTTCTAGCATATA
AGTCAAGTTTGGCTTTAGAAGAGAATGCAAAGCATATGGTTAAATGTGGAAGTGGAATATGATCACAACATCAGCATTGAAAATTTAGGTAGAGA
ATAGAAAGTAGAAAGACACACCAAAAGGCTCTCTTTTGATGGTTGAATATTTTTACTTCTTTTTCTTTTTTGGTTGGCTGAAAATAAAATGTTTC
GTTGAATTTGCN
AGTCAAGTTTGGCTTTAGAAGAGAATGCAAAGCATATGGTTAAATGTGGAAGTGGAATATGATCACAACATCAGCATTGAAAATTTAGGTAGAGA
ATAGAAAGTAGAAAGACACACCAAAAGGCTCTCTTTTGATGGTTGAATATTTTTACTTCTTTTTCTTTTTTGGTTGGCTGAAAATAAAATGTTTC
GTTGAATTTGCN
Unigenes |
Current Unigene builds | |||||
[SGN-E308476] | SGN-U564018 | Tomato 200607 | Build 2 | 46 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T120775 [Download] [View] | Facility Assigned ID: TRYDD38TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.893 | Expected Error Rate: 0.0052 | Quality Trim Threshold: 12.5 |