EST details — SGN-E308842

Search information 
Request: 308842Match: SGN-E308842
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97723Clone name: cLEY-23-A13
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308842Length: 248 bp (839 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308842 [] (trimmed) GTCCATTTCCACGAAAATACTAAGATAGTACTTAATTATTAGGTTGTGGAGTCTGATTAATATATATAGTTATTTAAGAAGTTTAACAGGTGAAA
TTGCCAGGGGTTATGGAGTGTGGGAGCCCCCATCCGAAGGAGGGTTTGGGGCGCTGCCCCGACCTAAATTTTAGGCTGTAGTATTTTTTCTCTGT
AACCAAAAGTATTCTGATTTATCAATATATATGTAATCAAAAGTATTCTGATTTATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308842] SGN-U566691 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121135 [Download] [View] Facility Assigned ID: TRYDK07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5