EST details — SGN-E308906

Search information 
Request: 308906Match: SGN-E308906
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97768Clone name: cLEY-23-D14
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308906Length: 351 bp (957 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308906 [] (trimmed) GCAGGAAAGTGTTGAGAGACAACATTCAAGGAATTACAAAGCCAGCTATTCGAAGACTCGCTCGTAGAGGTGGTGTGAAGCGTATTTCTGGGTTG
ATTTACGAAGAGACTCGTGGTGTTCTGAAGATCTTTTTGGAAAATGTAATTCGTGATTCCGTGACATACACAGAGCACGCTAGGAGAAAGACGGT
TACTGCTATGGATGTTGTTTATGCGCTTAAGAGGCAAGGAAGGACCCTTTACGGATTTGGGGGTTAGGGTTTGCCTTACGATTGTTAATTTTATT
CTCATCTTTGATGGTGTAATTCTCTGTTATACTAATTCAAAGAATAGAGTTTTTCTTATTCTGTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308906] SGN-U577794 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121199 [Download] [View] Facility Assigned ID: TRYDN19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0061 Quality Trim Threshold: 12.5