EST details — SGN-E308991

Search information 
Request: 308991Match: SGN-E308991
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97854Clone name: cLEY-23-L17
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E308991Length: 476 bp (936 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E308991 [] (trimmed) CTCCTCCTCCACGGTTAGAGAGAGAGTGAGAGATATAGAGCAGAGAGAGAGAGCGAGCGTGAGAGTGAGAGAGAGAGACAGAGAGATCCCTGGCG
AAGATCCTCAAACCGATTGTCCAGGGGAAGATGGAAGCTCAGACTCCAAAGACAAGTCATCAAAGAAAAGATGGTTCAACCTTAACCTTAAAGGA
TCAGATAAAAAGAACTGAAAAGTCGACGATCATCTAAGTTCTATACTTGATCCCAAATCTTAAAGAGTTCTTGCATTGCTATCAAACGCCAAGGG
GGCAGGTATTGCGCTGCCGGAACAAGTCCCTTCATATATTCTTTGTTCTATTTGTTAGTTTGTGCTTTTCCCAGATTCATTTTGTCTTTAGGGAA
GTGATGTTTGGAATATATATATATATATATATAGATGGGGTTTTTGGTGTTTGTATGCATGATTCTTGTGATGTACCATGAACTTGGCTGATCTT
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E308991] SGN-U574491 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121284 [Download] [View] Facility Assigned ID: TRYDM69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0238 Quality Trim Threshold: 12.5