Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E309015

Search information 
Request: 309015Match: SGN-E309015
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99899Clone name: cLEZ-1-A1
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99899 [cLEZ-1-A1] Trace: SGN-T121706 EST: SGN-E309016 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309015Length: 584 bp (894 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309015 [] (trimmed) GATTTTTTGTTTCTCTACTCCAATTGGGTGTTTTTTGTTTTTCTTTTTGTGTATCCATAAATGGGTAGTGAAACAAAGGTTTATACTTTGCAAGA
AGTAGCTCCTCACAACAATGCCAAAGATTGTTGGCTTGTTATTAGTGGCAAGGTGTACGATGTGACAAAGTTCTTGGACGATCACCCTGGTGGCG
ATGAGGTTTTATTAGCTGCTACTGGAAAGGATGCAACCGATGATTTTGAGGATGTTGGTCACAGCAGCAGTGCTCGAGCCATGTTGGACGAGTAC
TACGTAGGGGATATTGATTCAGCAACCATCCCGACTAAAAAGGCGTACACTCCTCCCAATCAGCCTCATTACAATCAGGACAACACATCCGAATT
CATAATCAAGCTACTCCAGTTCTTAGTTCCCCTGATCATTTTGGGCGTAGCAGTTGGCATCCGCTTCTACACCAAACAATCCTCTTGAAGATTGA
ATGCAACGGTAAATAAATTCATAATAAGAGTTCGAATTTGCAAGATGTCACCCTCGATTCAAAAAAAATATATATCGAATTTTACTTCTTAGACT
TCATATAGTCGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309015] SGN-U576176 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121705 [Download] [View] Facility Assigned ID: TRZAA01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0030 Quality Trim Threshold: 14.5