Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E309016

Search information 
Request: 309016Match: SGN-E309016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99899Clone name: cLEZ-1-A1
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99899 [cLEZ-1-A1] Trace: SGN-T121705 EST: SGN-E309015 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309016Length: 441 bp (787 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E309016 [] (trimmed) GGAGAGTACATTAACAACTTTTGACTAATAGGTTTGACTGAACTCAATAGTTTCAACAAATATCAAGTTTTGAACCCATAATTTCAAAGCTACGT
CGAATTCAATACTAAAAAGCTTAAAAATGTTGAAACGTCTCGAGATTAAAATCTCGAATCCACACTCTATAGGATGACTCAACAATCTATTACAA
CAAGAACATACGACTATATGAAGTCTAAGAAGTAAAATTCGATATATATTTTTTTTGAATCGAGGGTGACATCTTGCAAATTCGAACTCTTATTA
TGAATTTATTTACCGGTGCATTCAATCTTCAAGAGGATTGTTTGGTGTAAAAGCGGATGCCAACTGCTACGCCCAAAATGATCAGGGGAACTAAG
AACTGGAGTAGCTTGATTATGAATTCGGATGTGTTGTCCTGATTGTAATGAGGCTGATTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309016] SGN-U576176 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121706 [Download] [View] Facility Assigned ID: TRZAA01TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0067 Quality Trim Threshold: 20.5