EST details — SGN-E309159

Search information 
Request: 309159Match: SGN-E309159
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98716Clone name: cLEZ-12-A21
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309159Length: 534 bp (986 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E309159 [] (trimmed) AATTGTCAAACAATCAAATTCTGAGTTGTAAAGCTTCAGAAGTTATGGGAAAGGACTCCAAGTCTAAGGATTCTGGAAGCAAGGGAAAGGGTAAA
CAGGCTGCTGGTGGAAGTGAGGATAATGCTTCGAAAGGAAAAGGAAAAGGTGGGAAAGGAGATGGCCTTGGAACCTGCACATATGTTAAAGCAAG
GCATGTCTTATGTGAGAAGCAGTCAAAGATTAATGAAGCATACAAAATACTACAGGAAGGCTGGCTGAACAACGGAGATAAAGTTCCACCAGCTG
AGTTTGCTAAGGTAGCTGCAACTTACTCGGAATGCCCCTCAGGAAAGAAAGGTGGGGACCTGGGATGGTTTCCACGTGGCAAGATGGCAGGCCCA
TTTCAGGAAGTTGCCTTCAATACCCCTGTTGGAGCTACCAGTGCACCCTTTAAATCAACACATGGATACCATTTCATTTTATCTGAAGGGAGGAA
GAACTGAAATCTCTGAGCATTTAGATAGACATGGGATAGTGGCAGTTGTAGCAGAGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309159] SGN-U564374 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T122766 [Download] [View] Facility Assigned ID: TRZBS11TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0130 Quality Trim Threshold: 12.5