| SGN ID: SGN-C97534 | Clone name: cLEY-22-A6 |  | Order Clone |
|
| Library Name: cLEY | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: root
Development Stage: pre-anthesis/pre-fruit loading
Microarray: Alias clone
SGN-C186131 is on microarray TOM1: SGN-S1-1-8.4.5.10
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E309353 | Length: 240 bp (907 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E309353 [] (trimmed)
GCATCGCTGCTGCTTTGATGTAGAGGTGACACGTGTACTAACACGTGTCTTGTTCTTTTGATGGACGGACGAGATTTGTTTTTTCTAATACTTTA
AATTACTTTTTGTAATTTTGTGATTTATTTGTTTTTGGTACATTGTGGGTTTTTTATTTTTATTTTTATTTTGTTAATTATATTTTTCATTTTAG
AGTGAATCATTCATCATCCTTGTGTACATTTTAAGTGAAATAAATTTGAG
[BLAST] [AA Translate]
| SGN-ID: SGN-T121058 [Download] [View] |
Facility Assigned ID: TRYDH03TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
| Sequence Entropy: 0.840 |
Expected Error Rate: 0.0001 |
Quality Trim Threshold: 12.5 |
