EST details — SGN-E309608

Search information 
Request: 309608Match: SGN-E309608
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98273Clone name: cLEY-26-O18
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193281 [TUS-67-M23] Trace: SGN-T345997 EST: SGN-E545122 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193281 [TUS-67-M23] Trace: SGN-T350030 EST: SGN-E549155 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309608Length: 302 bp (977 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309608 [] (trimmed) GGGGGAATTTAAAAGGGACAACACTAAGGGCTAAAGATATTGCTGAGGCAGCTTTATATTTAGCTAGTGATGAATCAAGATATGTAAGTGGACAT
AATCTTGTTGTGGATGGTGGAGTTACTACATCAAGAAATTGTATTGGTTTGTAATGTATGTTTTTTTTTTGGGTAAAAGTTTTAATTTCTAACTT
AAAAAGAGCTTAACATATAGATTTATTGGGTTGAAATTTGATGTAATTTCTTCCTTTTTCCTATTTCGAATTGACCGAAGAAATTAAAAAGTTGT
CAGCTTAACTAGATGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309608] SGN-U564813 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121426 [Download] [View] Facility Assigned ID: TRYDX93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5