EST details — SGN-E309660

Search information 
Request: 309660Match: SGN-E309660
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C98265Clone name: cLEY-26-N4
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309660Length: 291 bp (937 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E309660 [] (trimmed) TGATTTTCTCCATGCTATGTTTGGTCTTTCTTGTTGGCAAAAGCTAGATAGATATATTCTATTCTATACTAGCCAGCCTGCATACAAAGTCAGAA
CCATATGTTGAGTAGTAAAATTATGACGACTGTTGAACTTCGAGCATCTGATTTATCACATGTCTCCATTTTCTTGCTCAACTATTTGAAGAAAT
ATAGTTGATGTTGGTTAGTGGATTCGAAGTGATGAACTAACTATTTGCTTTGATCCATAATGTCTAAATTGCTGCTGCTGTGATATTTACATTTG
CAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309660] SGN-U573895 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121478 [Download] [View] Facility Assigned ID: TRYDZ74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5